1403444: SHENTEK® rcAAV-2/N Quantitation Kit
1403444: SHENTEK® rcAAV-2/N Quantitation Kit
Couldn't load pickup availability
Share
SHENTEK® rcAAV Quantitation Kit is suitable for qPCR detection of
replication-competent adeno-associated virus (rcAAV) from cell culture harvested bulk and purified stock. This Kit is designed for the quantification of rcAAV-2/N contamination in serotypes of rAAV-2/N (N stands for possible different capsid serotypes). The sample types include but not limited to recombinant adeno-associated virus (rAAV) bulk and end-products, as well as harvested samples from cell culture desired for rcAAV detection.
Key information before using this kit:
1. AAV serotypes
2. The inverted terminal repeat (ITR) sequence of the test sample rAAV need to
match the following sequences:
ITR sequence of rAAV-2/N
TTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGACC
AAAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCGAG
CGAGCGCGCAGAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCT
SHENTEK® rcAAV Quantitation Kit is suitable for qPCR detection of
replication-competent adeno-associated virus (rcAAV) from cell culture harvested bulk and purified stock. This Kit is designed for the quantification of rcAAV-2/N contamination in serotypes of rAAV-2/N (N stands for possible different capsid serotypes). The sample types include but not limited to recombinant adeno-associated virus (rAAV) bulk and end-products, as well as harvested samples from cell culture desired for rcAAV detection.
Key information before using this kit:
1. AAV serotypes
2. The inverted terminal repeat (ITR) sequence of the test sample rAAV need to
match the following sequences:
ITR sequence of rAAV-2/N
TTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGACC
AAAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCGAG
CGAGCGCGCAGAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCT
This is an answer
When can I expect my order to ship? Most orders are filled and shipped within 2-3 business days from the time they are received. Our standard shipping usually take 2-5 days. We also provide express shippping for time-sensitive deliveries. Email info@genelabx.com if you have any requirements.This is an answer
When can I expect my order to ship? Most orders are filled and shipped within 2-3 business days from the time they are received. Our standard shipping usually take 2-5 days. We also provide express shippping for time-sensitive deliveries. Email info@genelabx.com if you have any requirements.